| Summary: | This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, <span style="font-variant: small-caps;">l</span>-leucine; R, <span style="font-variant: small-caps;">l</span>-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH<sub>2</sub>)<sub>6</sub>GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag<sup>0</sup>) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA–PVS–Ag<sup>0</sup>) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA–PVS–Ag<sup>0</sup> nanocomposites were polydispersed and contained embedded Ag<sup>0</sup>. Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01–0.1 ng L<sup>−1</sup> MC-LR and 0.003 ng L<sup>−1</sup> MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses excellent selectivity for MC-LR.
|
|---|
