Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures

ε-poly-<span style="font-variant: small-caps;">l</span>-Lysine (ε-PLL) peptide is a product of the marine bacterium <i>Bacillus subtilis</i> with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL an...

Full description

Bibliographic Details
Main Authors:	Maria Marzano, Andrea Patrizia Falanga, Daniela Marasco, Nicola Borbone, Stefano D’Errico, Gennaro Piccialli, Giovanni Nicola Roviello, Giorgia Oliviero
Format:	Article
Language:	English
Published:	MDPI AG 2020-01-01
Series:	Marine Drugs
Subjects:	marine peptide epsilon-poly-<span style="font-variant: small-caps">l</span>-lysine ε-pll g-quadruplex dna human telomere c-myc oncogene
Online Access:	https://www.mdpi.com/1660-3397/18/1/49

id	doaj-1982e6d8b4274ee9888ffae36d48c85b
record_format	Article
spelling	doaj-1982e6d8b4274ee9888ffae36d48c85b2020-11-25T01:47:08ZengMDPI AGMarine Drugs1660-33972020-01-011814910.3390/md18010049md18010049Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA StructuresMaria Marzano0Andrea Patrizia Falanga1Daniela Marasco2Nicola Borbone3Stefano D’Errico4Gennaro Piccialli5Giovanni Nicola Roviello6Giorgia Oliviero7Department of Pharmacy, University of Naples Federico II, Via Domenico Montesano 49, 80131 Naples, ItalyDepartment of Pharmacy, University of Naples Federico II, Via Domenico Montesano 49, 80131 Naples, ItalyDepartment of Pharmacy, University of Naples Federico II, Via Domenico Montesano 49, 80131 Naples, ItalyDepartment of Pharmacy, University of Naples Federico II, Via Domenico Montesano 49, 80131 Naples, ItalyDepartment of Pharmacy, University of Naples Federico II, Via Domenico Montesano 49, 80131 Naples, ItalyDepartment of Pharmacy, University of Naples Federico II, Via Domenico Montesano 49, 80131 Naples, ItalyInstitute of Biostructures and Bioimaging—CNR 1, Via Mezzocannone 16, 80134 Naples, ItalyDepartment of Molecular Medicine and Medical Biotechnologies, University of Napoli Federico II, Via Sergio Pansini 5, 80131 Naples, Italyε-poly-<span style="font-variant: small-caps;">l</span>-Lysine (ε-PLL) peptide is a product of the marine bacterium <i>Bacillus subtilis</i> with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-<span style="font-variant: small-caps;">l</span>-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.https://www.mdpi.com/1660-3397/18/1/49marine peptideepsilon-poly-<span style="font-variant: small-caps">l</span>-lysineε-pllg-quadruplex dnahuman telomerec-myc oncogene
collection	DOAJ
language	English
format	Article
sources	DOAJ
author	Maria Marzano Andrea Patrizia Falanga Daniela Marasco Nicola Borbone Stefano D’Errico Gennaro Piccialli Giovanni Nicola Roviello Giorgia Oliviero
spellingShingle	Maria Marzano Andrea Patrizia Falanga Daniela Marasco Nicola Borbone Stefano D’Errico Gennaro Piccialli Giovanni Nicola Roviello Giorgia Oliviero Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures Marine Drugs marine peptide epsilon-poly-<span style="font-variant: small-caps">l</span>-lysine ε-pll g-quadruplex dna human telomere c-myc oncogene
author_facet	Maria Marzano Andrea Patrizia Falanga Daniela Marasco Nicola Borbone Stefano D’Errico Gennaro Piccialli Giovanni Nicola Roviello Giorgia Oliviero
author_sort	Maria Marzano
title	Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures
title_short	Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures
title_full	Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures
title_fullStr	Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures
title_full_unstemmed	Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures
title_sort	evaluation of an analogue of the marine ε-pll peptide as a ligand of g-quadruplex dna structures
publisher	MDPI AG
series	Marine Drugs
issn	1660-3397
publishDate	2020-01-01
description	ε-poly-<span style="font-variant: small-caps;">l</span>-Lysine (ε-PLL) peptide is a product of the marine bacterium <i>Bacillus subtilis</i> with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-<span style="font-variant: small-caps;">l</span>-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.
topic	marine peptide epsilon-poly-<span style="font-variant: small-caps">l</span>-lysine ε-pll g-quadruplex dna human telomere c-myc oncogene
url	https://www.mdpi.com/1660-3397/18/1/49
work_keys_str_mv	AT mariamarzano evaluationofananalogueofthemarineepllpeptideasaligandofgquadruplexdnastructures AT andreapatriziafalanga evaluationofananalogueofthemarineepllpeptideasaligandofgquadruplexdnastructures AT danielamarasco evaluationofananalogueofthemarineepllpeptideasaligandofgquadruplexdnastructures AT nicolaborbone evaluationofananalogueofthemarineepllpeptideasaligandofgquadruplexdnastructures AT stefanoderrico evaluationofananalogueofthemarineepllpeptideasaligandofgquadruplexdnastructures AT gennaropiccialli evaluationofananalogueofthemarineepllpeptideasaligandofgquadruplexdnastructures AT giovanninicolaroviello evaluationofananalogueofthemarineepllpeptideasaligandofgquadruplexdnastructures AT giorgiaoliviero evaluationofananalogueofthemarineepllpeptideasaligandofgquadruplexdnastructures
_version_	1725016069264900096

Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures

Similar Items