Molecular Study on The Pathogenicity of Avian Influenza Virus

• Main Authors: Haryadi M. Wibowo, Heru Susetya, Tri Untari, Khrisdiana Putri, Charles Rangga Tabbu
• Format: Article
• Language: English
• Published: Universitas Gadjah Mada, Yogyakarta 2006-12-01
• Series: Indonesian Journal of Biotechnology
• Online Access: https://jurnal.ugm.ac.id/ijbiotech/article/view/7567

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) based on multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose of this work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from both cases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primer desaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5- R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenza virus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic amino acid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HA genefragment indicated that each type of characteristic lesion created philo-groups. Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.