Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver Nanocomposite
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, <span style="font-variant: small-caps;">l</span>-leucine; R, <span style="font-variant: small-caps;">l</span>-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA a...
Main Authors: | , , , |
---|---|
Format: | Article |
Language: | English |
Published: |
MDPI AG
2021-01-01
|
Series: | Processes |
Subjects: | |
Online Access: | https://www.mdpi.com/2227-9717/9/1/179 |
id |
doaj-c502acdf1ba846e5ac7388daceeb9373 |
---|---|
record_format |
Article |
spelling |
doaj-c502acdf1ba846e5ac7388daceeb93732021-01-20T00:02:38ZengMDPI AGProcesses2227-97172021-01-01917917910.3390/pr9010179Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver NanocompositeMawethu Pascoe Bilibana0Usisipho Feleni1Avril Rae Williams2Emmanuel Iwuoha3SensorLab (University of Western Cape Sensor Laboratories), Chemical Sciences Building, University of the Western Cape, Bellville 7535, Cape Town, South AfricaInstitute for Nanotechnology and Water Sustainability (iNanoWS), Florida Campus, College of Science, Engineering and Technology, University of South Africa, Johannesburg 1710, South AfricaDepartment of Biological and Chemical Sciences, University of the West Indies, Cave Hill Campus, Bridgetown BB11000, BarbadosSensorLab (University of Western Cape Sensor Laboratories), Chemical Sciences Building, University of the Western Cape, Bellville 7535, Cape Town, South AfricaThis paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, <span style="font-variant: small-caps;">l</span>-leucine; R, <span style="font-variant: small-caps;">l</span>-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH<sub>2</sub>)<sub>6</sub>GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag<sup>0</sup>) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA–PVS–Ag<sup>0</sup>) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA–PVS–Ag<sup>0</sup> nanocomposites were polydispersed and contained embedded Ag<sup>0</sup>. Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01–0.1 ng L<sup>−1</sup> MC-LR and 0.003 ng L<sup>−1</sup> MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses excellent selectivity for MC-LR.https://www.mdpi.com/2227-9717/9/1/179electrochemical aptasensormicrocystin-LRpoly(2,5-dimethoxyaniline)silver nanoparticlessmall-angle X-ray scattering spectroscopy (SAXS) |
collection |
DOAJ |
language |
English |
format |
Article |
sources |
DOAJ |
author |
Mawethu Pascoe Bilibana Usisipho Feleni Avril Rae Williams Emmanuel Iwuoha |
spellingShingle |
Mawethu Pascoe Bilibana Usisipho Feleni Avril Rae Williams Emmanuel Iwuoha Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver Nanocomposite Processes electrochemical aptasensor microcystin-LR poly(2,5-dimethoxyaniline) silver nanoparticles small-angle X-ray scattering spectroscopy (SAXS) |
author_facet |
Mawethu Pascoe Bilibana Usisipho Feleni Avril Rae Williams Emmanuel Iwuoha |
author_sort |
Mawethu Pascoe Bilibana |
title |
Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver Nanocomposite |
title_short |
Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver Nanocomposite |
title_full |
Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver Nanocomposite |
title_fullStr |
Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver Nanocomposite |
title_full_unstemmed |
Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver Nanocomposite |
title_sort |
impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite |
publisher |
MDPI AG |
series |
Processes |
issn |
2227-9717 |
publishDate |
2021-01-01 |
description |
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, <span style="font-variant: small-caps;">l</span>-leucine; R, <span style="font-variant: small-caps;">l</span>-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH<sub>2</sub>)<sub>6</sub>GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag<sup>0</sup>) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA–PVS–Ag<sup>0</sup>) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA–PVS–Ag<sup>0</sup> nanocomposites were polydispersed and contained embedded Ag<sup>0</sup>. Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01–0.1 ng L<sup>−1</sup> MC-LR and 0.003 ng L<sup>−1</sup> MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses excellent selectivity for MC-LR. |
topic |
electrochemical aptasensor microcystin-LR poly(2,5-dimethoxyaniline) silver nanoparticles small-angle X-ray scattering spectroscopy (SAXS) |
url |
https://www.mdpi.com/2227-9717/9/1/179 |
work_keys_str_mv |
AT mawethupascoebilibana impedimetricmicrocystinlraptasensorpreparedwithsulfonatedpoly25dimethoxyanilinesilvernanocomposite AT usisiphofeleni impedimetricmicrocystinlraptasensorpreparedwithsulfonatedpoly25dimethoxyanilinesilvernanocomposite AT avrilraewilliams impedimetricmicrocystinlraptasensorpreparedwithsulfonatedpoly25dimethoxyanilinesilvernanocomposite AT emmanueliwuoha impedimetricmicrocystinlraptasensorpreparedwithsulfonatedpoly25dimethoxyanilinesilvernanocomposite |
_version_ |
1724331652073652224 |