Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver Nanocomposite

• Main Authors: Mawethu Pascoe Bilibana, Usisipho Feleni, Avril Rae Williams, Emmanuel Iwuoha
• Format: Article
• Language: English
• Published: MDPI AG 2021-01-01
• Series: Processes
• Subjects: electrochemical aptasensor; microcystin-LR; poly(2,5-dimethoxyaniline); silver nanoparticles; small-angle X-ray scattering spectroscopy (SAXS)
• Online Access: https://www.mdpi.com/2227-9717/9/1/179

This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, <span style="font-variant: small-caps;">l</span>-leucine; R, <span style="font-variant: small-caps;">l</span>-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH₂)₆GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag⁰) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA–PVS–Ag⁰) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA–PVS–Ag⁰ nanocomposites were polydispersed and contained embedded Ag⁰. Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01–0.1 ng L⁻¹ MC-LR and 0.003 ng L⁻¹ MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses excellent selectivity for MC-LR.